Molecular S2013 Assignment 1

Objectives:
Understand the base pairing and orientation relationships between complementary strands of nucleic acid
Understand the distinctons between sense and template strands of DNA and the sequence relationship with a transcribed RNA
Be able to use a codon table
Be able to distinguish silent, missense and frameshift mutations





5' AACAATGATCCGCACACACTGA 3'




write the sequence of complementary strand of DNA (indicate 5',3' ends)


use the DNA strand you just wrote as the template for RNA synthesis (indicate 5',3' ends)
                                                                                                                                                                        

use the RNA strand as the template for protein synthesis--start at the start codon, indicate N and C termini; use 1 letter amino acid abbreviations.



what term (begins with "a") describes the relative orientations between the 2 complementary strands of DNA?
 		                                                                                           
            

                                            
the original strand above is often referred to as the "sense" strand.  Compare this sequence with the RNA strand and explain why this term "makes sense".

                                                                                                                                                                                               





5' AACAATGATCCGCACACACTGA 3'                           
the sequence to the left is the same as that above
5' AACAATGATTCGCACACACTGA 3'

 the sequence to the left is the same as that above except for the indicated substitution.  What effect would this substitution have on the gene product?

5' AACAATGAGCCGCACACACTGA 3'

the sequence to the left is the same as that above except for the indicated substitution.  What effect would this substitution have on the gene product?

5' AACAATGATCCCGCACACACTGA 3' the sequence to the left is the same as that above except for the indicated insertion.  What effect would this insertion have on the gene product?





Categorize each of the above  "mutations" as silent, missense or frameshift mutations.  If occurring as part of a real protein, which would be expected to be most deleterious to the function of the protein?